Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Molecular Testing
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • How to Order
    • Instrument Support
    • Learning Centers
    • Register for an Account
    • Technical Support Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • New Products
  • Promotions
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Promos
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Aspire Member Program
            • Connect: Lab, Data, Apps
            • Custom Products & Projects
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C___2615208_20
          See other BRCA1 GT Assays ›
          SNP ID:
          rs1799966
          Gene
          BRCA1
          Gene Name
          BRCA1, DNA repair associated
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.17: 43071077 - 43071077 on Build GRCh38
          Polymorphism:
          C/T, Transition substitution
          Context Sequence [VIC/FAM]:

          TCAGTAGTATGAGCAGCAGCTGGAC[C/T]CTGGGCAGATTCTGCAACTTTCAAT

          Assay ID C___2615208_20
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 113705

          Literature Links:

          BRCA1 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          G (0.36)
          (0.64)
          Caucasian - Not Available CEPH (CEU)
          G (0.31)
          (0.69)
          EAS
          G (0.37)
          (0.63)
          African American - Not Available YRI (Yoruba)
          G (0.17)
          (0.83)
          SAS
          G (0.50)
          (0.50)
          Chinese - Not Available JPT (Japanese)
          G (0.27)
          (0.73)
          AFR
          G (0.23)
          (0.77)
          Japanese - Not Available CHB (Han Chinese)
          G (0.31)
          (0.69)
          EUR
          G (0.36)
          (0.64)
          AMR
          G (0.38)
          (0.62)
          BRCA1 - BRCA1, DNA repair associated
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_007294.3 5132 Missense Mutation NP_009225.1
          NM_007297.3 5132 Missense Mutation NP_009228.2
          NM_007298.3 5132 Missense Mutation NP_009229.2
          NM_007299.3 5132 Missense Mutation NP_009230.2
          NM_007300.3 5132 Missense Mutation NP_009231.2

          Back To Top

          More Information


          Set Membership:

          HapMap

          Panther Classification:

          Molecular Function -

          ubiquitin-protein ligase protein modifying enzyme

          Gene Ontology Categories:

          Function(s) Process(es)

          double-strand break repair via homologous recombination
          DNA double-strand break processing
          DNA synthesis involved in DNA repair
          strand displacement
          DNA replication
          postreplication repair
          double-strand break repair
          double-strand break repair via nonhomologous end joining
          regulation of gene expression by genetic imprinting
          transcription, DNA-templated
          regulation of transcription from RNA polymerase II promoter
          regulation of transcription from RNA polymerase III promoter
          fatty acid biosynthetic process
          apoptotic process
          cellular response to DNA damage stimulus
          DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator
          chromosome segregation
          centrosome cycle
          brain development
          response to nutrient
          intrinsic apoptotic signaling pathway in response to DNA damage
          dosage compensation by inactivation of X chromosome
          response to ionizing radiation
          positive regulation of vascular endothelial growth factor production
          positive regulation of gene expression
          protein ubiquitination
          protein sumoylation
          androgen receptor signaling pathway
          chromosome breakage
          positive regulation of protein ubiquitination
          G2 DNA damage checkpoint
          response to estradiol
          negative regulation of intracellular estrogen receptor signaling pathway
          positive regulation of protein import into nucleus, translocation
          positive regulation of histone acetylation
          negative regulation of histone acetylation
          regulation of cell proliferation
          regulation of apoptotic process
          chordate embryonic development
          response to estrogen
          regulation of DNA methylation
          negative regulation of fatty acid biosynthetic process
          positive regulation of DNA repair
          positive regulation of angiogenesis
          negative regulation of transcription, DNA-templated
          positive regulation of transcription, DNA-templated
          positive regulation of transcription from RNA polymerase II promoter
          negative regulation of centriole replication
          positive regulation of histone H3-K4 methylation
          negative regulation of histone H3-K4 methylation
          negative regulation of histone H3-K9 methylation
          positive regulation of histone H3-K9 methylation
          protein autoubiquitination
          positive regulation of histone H4-K20 methylation
          positive regulation of cell cycle arrest
          cellular response to tumor necrosis factor
          cellular response to indole-3-methanol
          protein K6-linked ubiquitination
          regulation of signal transduction by p53 class mediator
          negative regulation of extrinsic apoptotic signaling pathway via death domain receptors
          negative regulation of reactive oxygen species metabolic process
          positive regulation of histone H3-K9 acetylation
          positive regulation of histone H4-K16 acetylation
          DNA binding
          chromatin binding
          damaged DNA binding
          transcription coactivator activity
          RNA binding
          ubiquitin-protein transferase activity
          protein binding
          zinc ion binding
          tubulin binding
          ligase activity
          enzyme binding
          ubiquitin protein ligase binding
          transcription regulatory region DNA binding
          androgen receptor binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Consumer Health Data Privacy Policy Consumer Health Data Privacy Policy
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Notice
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          United States flag icon
          United States

          Your items have has been added!


          Host server : magellan-search-green-79565875f6-xmwlv:80/100.66.76.16:80.
          git-commit: 280dcbe45276d5d6e613c14d399020b8a49b7116
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.57.0-Offline