Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Estatus del pedido
            • Productos personalizados y proyectos​
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C___3219460_20
          See other NOS3 GT Assays ›
          SNP ID:
          rs1799983
          Gene
          NOS3
          Gene Name
          nitric oxide synthase 3
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.7: 150999023 - 150999023 on Build GRCh38
          Polymorphism:
          G/T, Transversion substitution
          Context Sequence [VIC/FAM]:

          CCCTGCTGCTGCAGGCCCCAGATGA[G/T]CCCCCAGAACTCTTCCTTCTGCCCC

          Assay ID C___3219460_20
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 163729

          Literature Links:

          NOS3 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          T (0.18)
          (0.82)
          Caucasian - Not Available CEPH (CEU)
          T (0.34)
          (0.66)
          EAS
          T (0.13)
          (0.87)
          African American - Not Available YRI (Yoruba)
          T (0.07)
          (0.93)
          SAS
          T (0.17)
          (0.83)
          Chinese - Not Available JPT (Japanese)
          T (0.07)
          (0.93)
          AFR
          T (0.07)
          (0.93)
          Japanese - Not Available CHB (Han Chinese)
          T (0.11)
          (0.89)
          EUR
          T (0.34)
          (0.66)
          AMR
          T (0.22)
          (0.78)
          NOS3 - nitric oxide synthase 3
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000603.4 947 Missense Mutation GAG,GAT E,D 298 NP_000594.2
          NM_001160109.1 947 Missense Mutation GAG,GAT E,D 298 NP_001153581.1
          NM_001160110.1 947 Missense Mutation GAG,GAT E,D 298 NP_001153582.1
          NM_001160111.1 947 Missense Mutation GAG,GAT E,D 298 NP_001153583.1
          XM_006716002.3 947 Missense Mutation GAG,GAT E,D 298 XP_006716065.1
          XM_017012232.1 947 Missense Mutation GAG,GAT E,D 298 XP_016867721.1
          XM_017012233.1 947 Missense Mutation GAG,GAT E,D 92 XP_016867722.1
          XM_017012234.1 947 Missense Mutation GAG,GAT E,D 298 XP_016867723.1

          Back To Top

          More Information


          Set Membership:

          HapMap

          Panther Classification:

          Molecular Function -

          oxidoreductase protein modifying enzyme

          Gene Ontology Categories:

          Function(s) Process(es)

          angiogenesis
          ovulation from ovarian follicle
          in utero embryonic development
          blood vessel remodeling
          regulation of sodium ion transport
          regulation of the force of heart contraction by chemical signal
          regulation of systemic arterial blood pressure by endothelin
          arginine catabolic process
          nitric oxide biosynthetic process
          mitochondrion organization
          nitric oxide mediated signal transduction
          regulation of blood pressure
          negative regulation of cell proliferation
          response to heat
          negative regulation of platelet activation
          negative regulation of muscle hyperplasia
          smooth muscle hyperplasia
          removal of superoxide radicals
          lung development
          positive regulation of guanylate cyclase activity
          lipopolysaccharide-mediated signaling pathway
          response to fluid shear stress
          negative regulation of potassium ion transport
          endothelial cell migration
          cell redox homeostasis
          positive regulation of angiogenesis
          negative regulation of blood pressure
          positive regulation of vasodilation
          regulation of blood vessel size
          regulation of nitric-oxide synthase activity
          negative regulation of hydrolase activity
          negative regulation of calcium ion transport
          oxidation-reduction process
          negative regulation of extrinsic apoptotic signaling pathway via death domain receptors
          actin monomer binding
          nitric-oxide synthase activity
          iron ion binding
          protein binding
          calmodulin binding
          FMN binding
          heme binding
          tetrahydrobiopterin binding
          arginine binding
          cadmium ion binding
          flavin adenine dinucleotide binding
          NADP binding
          scaffold protein binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-blue-64dd947b88-tr4x4:80/100.66.75.98:80.
          git-commit: 0f46c0ba67a87c24f5ac662a3edafcaba07cd08c
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.45.0-Offline