Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Molecular Testing
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • How to Order
    • Instrument Support
    • Learning Centers
    • Register for an Account
    • Technical Support Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Promotions
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Promos
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Aspire Member Program
            • Connect: Lab, Data, Apps
            • Custom Products & Projects
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C___3272740_10
          See other LOC102724449 GT Assays ›
          SNP ID:
          rs4998557
          Gene
          LOC102724449 SCAF4 SOD1
          Gene Name
          uncharacterized LOC102724449
          SR-related CTD associated factor 4
          superoxide dismutase 1, soluble
          Set Membership:
          > HapMap > Validated
          Chromosome Location:
          Chr.21: 31662579 - 31662579 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          CATTACCTGAATGGCTATACTGCTT[A/G]CTTTCATTTTGGTAGAGTGGAAAGG

          Assay ID C___3272740_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 616023 MIM: 147450

          Literature Links:

          LOC102724449 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          A (0.33)
          (0.67)
          Caucasian
          A (0.10)
          (0.90)
          CEPH (CEU)
          A (0.12)
          (0.88)
          EAS
          G (0.48)
          (0.52)
          African American
          A (0.33)
          (0.67)
          YRI (Yoruba)
          A (0.43)
          (0.57)
          SAS
          A (0.24)
          (0.76)
          Japanese
          A (0.50)
          (0.50)
          JPT (Japanese)
          A (0.38)
          (0.62)
          AFR
          A (0.44)
          (0.56)
          Chinese
          G (0.46)
          (0.54)
          CHB (Han Chinese)
          G (0.46)
          (0.54)
          EUR
          A (0.13)
          (0.87)
          AMR
          A (0.26)
          (0.74)
          LOC102724449 - uncharacterized LOC102724449
          There are no transcripts associated with this gene.
          SCAF4 - SR-related CTD associated factor 4
          There are no transcripts associated with this gene.
          SOD1 - superoxide dismutase 1, soluble
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000454.4 Intron NP_000445.1

          Back To Top

          More Information


          Set Membership:

          HapMap Validated

          Panther Classification:

          Molecular Function -

          oxidoreductase

          Gene Ontology Categories:

          Function(s) Process(es)

          activation of MAPK activity
          response to reactive oxygen species
          response to superoxide
          ovarian follicle development
          positive regulation of cytokine production
          placenta development
          retina homeostasis
          response to amphetamine
          myeloid cell homeostasis
          platelet degranulation
          glutathione metabolic process
          superoxide metabolic process
          cellular iron ion homeostasis
          spermatogenesis
          embryo implantation
          cell aging
          sensory perception of sound
          locomotory behavior
          anterograde axonal transport
          retrograde axonal transport
          regulation of blood pressure
          response to heat
          response to organic substance
          transmission of nerve impulse
          removal of superoxide radicals
          response to nutrient levels
          peripheral nervous system myelin maintenance
          positive regulation of superoxide anion generation
          regulation of T cell differentiation in thymus
          response to carbon monoxide
          cellular response to potassium ion
          regulation of multicellular organism growth
          response to drug
          response to hydrogen peroxide
          superoxide anion generation
          positive regulation of apoptotic process
          positive regulation of catalytic activity
          regulation of GTPase activity
          negative regulation of neuron apoptotic process
          response to ethanol
          negative regulation of cholesterol biosynthetic process
          regulation of protein kinase activity
          regulation of organ growth
          response to antibiotic
          response to copper ion
          muscle cell cellular homeostasis
          thymus development
          response to axon injury
          hydrogen peroxide biosynthetic process
          regulation of mitochondrial membrane potential
          oxidation-reduction process
          heart contraction
          neurofilament cytoskeleton organization
          relaxation of vascular smooth muscle
          auditory receptor cell stereocilium organization
          cellular response to cadmium ion
          cellular response to ATP
          reactive oxygen species metabolic process
          response to antipsychotic drug
          positive regulation of oxidative stress-induced intrinsic apoptotic signaling pathway
          superoxide dismutase activity
          copper ion binding
          protein binding
          zinc ion binding
          protein phosphatase 2B binding
          identical protein binding
          protein homodimerization activity
          Rac GTPase binding
          chaperone binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Consumer Health Data Privacy Policy Consumer Health Data Privacy Policy
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Notice
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          United States flag icon
          United States

          Your items have has been added!


          Host server : magellan-search-green-794c4b9cd6-rd95r:80/100.66.77.199:80.
          git-commit: 7e8dd63fde7d4486b98ef9ac5cf4e365aa842ffe
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.52.0-Offline