Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C___3290335_10
          See other OXTR GT Assays ›
          SNP ID:
          rs53576
          Gene
          OXTR
          Gene Name
          oxytocin receptor
          Set Membership:
          -
          Chromosome Location:
          Chr.3: 8762685 - 8762685 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          AAAGGTGTACGGGACATGCCCGAGG[A/G]TCCTCAGTCCCACAGAAACAGGGAG

          Assay ID C___3290335_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 167055

          Literature Links:

          OXTR PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          A (0.39)
          (0.61)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          G (0.35)
          (0.65)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          A (0.45)
          (0.55)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          A (0.19)
          (0.81)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          A (0.35)
          (0.65)
          AMR
          A (0.36)
          (0.64)
          OXTR - oxytocin receptor
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000916.3 Intron NP_000907.2
          XM_011533762.2 Intron XP_011532064.1

          Back To Top

          More Information


          Additional Information:

          For this assay, SNP(s) [rs75943879] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

          Panther Classification:

          Molecular Function -

          G-protein coupled receptor

          Gene Ontology Categories:

          Function(s) Process(es)

          suckling behavior
          response to amphetamine
          regulation of systemic arterial blood pressure by vasopressin
          muscle contraction
          cell surface receptor signaling pathway
          G-protein coupled receptor signaling pathway
          positive regulation of cytosolic calcium ion concentration
          heart development
          female pregnancy
          lactation
          memory
          positive regulation of norepinephrine secretion
          telencephalon development
          sleep
          positive regulation of synaptic transmission, GABAergic
          response to estradiol
          response to progesterone
          cellular response to hormone stimulus
          response to anoxia
          response to cytokine
          social behavior
          response to cocaine
          response to drug
          maternal behavior
          sperm ejaculation
          eating behavior
          response to peptide hormone
          estrous cycle
          positive regulation of blood pressure
          positive regulation of vasoconstriction
          digestive tract development
          positive regulation of synapse assembly
          positive regulation of synaptic transmission, glutamatergic
          maternal process involved in parturition
          positive regulation of penile erection
          negative regulation of gastric acid secretion
          ERK1 and ERK2 cascade
          positive regulation of uterine smooth muscle contraction
          response to peptide
          oxytocin receptor activity
          vasopressin receptor activity
          peptide hormone binding
          peptide binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Responsibility Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-dd86746ff-ngdwv:80/100.66.78.131:80.
          git-commit: 04e44c58f20fafe66519586ffe6db5d8a90e52ce
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.53.1-Offline