Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Estatus del pedido
            • Productos personalizados y proyectos​
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C___3290335_10
          See other OXTR GT Assays ›
          SNP ID:
          rs53576
          Gene
          OXTR
          Gene Name
          oxytocin receptor
          Set Membership:
          -
          Chromosome Location:
          Chr.3: 8762685 - 8762685 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          AAAGGTGTACGGGACATGCCCGAGG[A/G]TCCTCAGTCCCACAGAAACAGGGAG

          Assay ID C___3290335_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 167055

          Literature Links:

          OXTR PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          A (0.39)
          (0.61)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          G (0.35)
          (0.65)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          A (0.45)
          (0.55)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          A (0.19)
          (0.81)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          A (0.35)
          (0.65)
          AMR
          A (0.36)
          (0.64)
          OXTR - oxytocin receptor
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000916.3 Intron NP_000907.2
          XM_011533762.2 Intron XP_011532064.1

          Back To Top

          More Information


          Additional Information:

          For this assay, SNP(s) [rs75943879] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

          Panther Classification:

          Molecular Function -

          G-protein coupled receptor

          Gene Ontology Categories:

          Function(s) Process(es)

          suckling behavior
          response to amphetamine
          regulation of systemic arterial blood pressure by vasopressin
          muscle contraction
          cell surface receptor signaling pathway
          G-protein coupled receptor signaling pathway
          positive regulation of cytosolic calcium ion concentration
          heart development
          female pregnancy
          lactation
          memory
          positive regulation of norepinephrine secretion
          telencephalon development
          sleep
          positive regulation of synaptic transmission, GABAergic
          response to estradiol
          response to progesterone
          cellular response to hormone stimulus
          response to anoxia
          response to cytokine
          social behavior
          response to cocaine
          response to drug
          maternal behavior
          sperm ejaculation
          eating behavior
          response to peptide hormone
          estrous cycle
          positive regulation of blood pressure
          positive regulation of vasoconstriction
          digestive tract development
          positive regulation of synapse assembly
          positive regulation of synaptic transmission, glutamatergic
          maternal process involved in parturition
          positive regulation of penile erection
          negative regulation of gastric acid secretion
          ERK1 and ERK2 cascade
          positive regulation of uterine smooth muscle contraction
          response to peptide
          oxytocin receptor activity
          vasopressin receptor activity
          peptide hormone binding
          peptide binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-5799cd5976-swbc5:80/100.66.77.38:80.
          git-commit: e30ab741173a2eb62411af663260592d4bdb9634
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.55.0-2026.07.30-1.0