Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Molecular Testing
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • How to Order
    • Instrument Support
    • Learning Centers
    • Register for an Account
    • Technical Support Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Promotions
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Promos
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Aspire Member Program
            • Connect: Lab, Data, Apps
            • Custom Products & Projects
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C___7546223_20
          See other ASCC2 GT Assays ›
          SNP ID:
          rs28265
          Gene
          ASCC2
          Gene Name
          activating signal cointegrator 1 complex subunit 2
          Set Membership:
          > HapMap > Validated
          Chromosome Location:
          Chr.22: 29804772 - 29804772 on Build GRCh38
          Polymorphism:
          C/G, Transversion substitution
          Context Sequence [VIC/FAM]:

          TTAGCATCTGTGGCTTTCCGTCTGT[C/G]CACCCCTTCCCATGCACTCTCGACT

          Assay ID C___7546223_20
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 614216

          Literature Links:

          ASCC2 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          C (0.04)
          (0.96)
          Caucasian
          G (0.03)
          (0.97)
          CEPH (CEU)
          G (0.04)
          (0.96)
          EAS
          G (0.00)
          (1.00)
          African American
          G (0.08)
          (0.92)
          YRI (Yoruba)
          G (0.18)
          (0.82)
          SAS
          C (0.01)
          (0.99)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          G (0.09)
          (0.91)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          G (0.06)
          (0.94)
          AMR
          G (0.05)
          (0.95)
          ASCC2 - activating signal cointegrator 1 complex subunit 2
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001242906.1 1403 Missense Mutation CAC,GAC H,D 331 NP_001229835.1
          NM_032204.4 1403 Missense Mutation CAC,GAC H,D 407 NP_115580.2
          XM_005261775.2 1403 Missense Mutation CAC,GAC H,D 407 XP_005261832.1
          XM_011530442.2 1403 Missense Mutation CAC,GAC H,D 407 XP_011528744.1
          XM_011530443.2 1403 Missense Mutation CAC,GAC H,D 407 XP_011528745.1
          XM_011530444.2 1403 Missense Mutation CAC,GAC H,D 407 XP_011528746.1
          XM_011530445.2 1403 Missense Mutation CAC,GAC H,D 407 XP_011528747.1
          XM_011530446.2 1403 Missense Mutation CAC,GAC H,D 407 XP_011528748.1
          XM_011530448.2 1403 Missense Mutation CAC,GAC H,D 354 XP_011528750.1
          XM_011530449.2 1403 Missense Mutation CAC,GAC H,D 354 XP_011528751.1
          XM_011530450.2 1403 Missense Mutation CAC,GAC H,D 293 XP_011528752.1
          XM_011530451.2 1403 Missense Mutation CAC,GAC H,D 293 XP_011528753.1
          XM_011530452.2 1403 Missense Mutation CAC,GAC H,D 293 XP_011528754.1
          XM_011530453.2 1403 Missense Mutation CAC,GAC H,D 293 XP_011528755.1
          XM_011530454.2 1403 Missense Mutation CAC,GAC H,D 293 XP_011528756.1
          XM_011530455.2 1403 Missense Mutation CAC,GAC H,D 293 XP_011528757.1
          XM_017028991.1 1403 Missense Mutation CAC,GAC H,D 461 XP_016884480.1
          XM_017028992.1 1403 Missense Mutation CAC,GAC H,D 461 XP_016884481.1
          XM_017028993.1 1403 Missense Mutation CAC,GAC H,D 436 XP_016884482.1
          XM_017028994.1 1403 Missense Mutation CAC,GAC H,D 436 XP_016884483.1
          XM_017028995.1 1403 Missense Mutation CAC,GAC H,D 408 XP_016884484.1
          XM_017028996.1 1403 Missense Mutation CAC,GAC H,D 407 XP_016884485.1
          XM_017028997.1 1403 Missense Mutation CAC,GAC H,D 408 XP_016884486.1
          XM_017028998.1 1403 Missense Mutation CAC,GAC H,D 407 XP_016884487.1
          XM_017028999.1 1403 Missense Mutation CAC,GAC H,D 407 XP_016884488.1
          XM_017029000.1 1403 Missense Mutation CAC,GAC H,D 407 XP_016884489.1
          XM_017029001.1 1403 Missense Mutation CAC,GAC H,D 354 XP_016884490.1
          XM_017029002.1 1403 Missense Mutation CAC,GAC H,D 354 XP_016884491.1
          XM_017029003.1 1403 Missense Mutation CAC,GAC H,D 354 XP_016884492.1
          XM_017029004.1 1403 Missense Mutation CAC,GAC H,D 329 XP_016884493.1
          XM_017029005.1 1403 Missense Mutation CAC,GAC H,D 293 XP_016884494.1
          XM_017029006.1 1403 Missense Mutation CAC,GAC H,D 293 XP_016884495.1
          XM_017029007.1 1403 Missense Mutation CAC,GAC H,D 293 XP_016884496.1
          XM_017029008.1 1403 Missense Mutation CAC,GAC H,D 293 XP_016884497.1
          XM_017029009.1 1403 Missense Mutation CAC,GAC H,D 293 XP_016884498.1

          Back To Top

          More Information


          Set Membership:

          HapMap Validated

          Gene Ontology Categories:

          Function(s)

          DNA dealkylation involved in DNA repair
          transcription, DNA-templated
          regulation of transcription, DNA-templated

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Consumer Health Data Privacy Policy Consumer Health Data Privacy Policy
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Notice
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          United States flag icon
          United States

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-9fm2r:80/100.66.79.29:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline