Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Molecular Testing
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • How to Order
    • Instrument Support
    • Learning Centers
    • Register for an Account
    • Technical Support Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Promotions
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Promos
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Aspire Member Program
            • Connect: Lab, Data, Apps
            • Custom Products & Projects
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C___8746719_20
          See other CLOCK GT Assays ›
          SNP ID:
          rs1801260
          Gene
          CLOCK TMEM165
          Gene Name
          clock circadian regulator
          transmembrane protein 165
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.4: 55435202 - 55435202 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          ACCTAAAACACTGTCAGAACTGGCT[A/G]TGCCCCTATGATCACCTCCTGCTGG

          Assay ID C___8746719_20
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 601851 MIM: 614726

          Literature Links:

          CLOCK PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          C (0.23)
          (0.77)
          Caucasian - Not Available CEPH (CEU)
          C (0.26)
          (0.74)
          EAS
          C (0.10)
          (0.90)
          African American - Not Available YRI (Yoruba)
          C (0.16)
          (0.84)
          SAS
          C (0.38)
          (0.62)
          Chinese - Not Available JPT (Japanese)
          C (0.21)
          (0.79)
          AFR
          C (0.15)
          (0.85)
          Japanese - Not Available CHB (Han Chinese)
          C (0.11)
          (0.89)
          EUR
          C (0.31)
          (0.69)
          AMR
          C (0.24)
          (0.76)
          CLOCK - clock circadian regulator
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001267843.1 2766 UTR 3 NP_001254772.1
          NM_004898.3 2766 UTR 3 NP_004889.1
          XM_005265787.2 2766 UTR 3 XP_005265844.1
          XM_011534409.2 2766 UTR 3 XP_011532711.1
          XM_011534410.2 2766 UTR 3 XP_011532712.1
          XM_011534411.2 2766 UTR 3 XP_011532713.1
          XM_017008854.1 2766 UTR 3 XP_016864343.1
          XM_017008855.1 2766 UTR 3 XP_016864344.1
          TMEM165 - transmembrane protein 165
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_018475.4 2766 Intron NP_060945.2
          XM_011534394.2 2766 Intron XP_011532696.1
          XM_017008412.1 2766 Intron XP_016863901.1

          Back To Top

          More Information


          Set Membership:

          HapMap

          Gene Ontology Categories:

          Function(s) Process(es)

          DNA damage checkpoint
          regulation of transcription, DNA-templated
          regulation of transcription from RNA polymerase II promoter
          transcription from RNA polymerase II promoter
          signal transduction
          spermatogenesis
          circadian rhythm
          photoperiodism
          entrainment of circadian clock
          histone acetylation
          circadian regulation of gene expression
          regulation of hair cycle
          proteasome-mediated ubiquitin-dependent protein catabolic process
          negative regulation of transcription, DNA-templated
          positive regulation of transcription, DNA-templated
          positive regulation of transcription from RNA polymerase II promoter
          positive regulation of inflammatory response
          regulation of insulin secretion
          positive regulation of NF-kappaB transcription factor activity
          response to redox state
          cellular response to ionizing radiation
          regulation of type B pancreatic cell development
          negative regulation of glucocorticoid receptor signaling pathway
          protein N-linked glycosylation
          cellular calcium ion homeostasis
          Golgi calcium ion transport
          regulation of lysosomal lumen pH
          RNA polymerase II core promoter proximal region sequence-specific DNA binding
          transcription factor activity, RNA polymerase II core promoter proximal region sequence-specific binding
          core promoter sequence-specific DNA binding
          core promoter binding
          transcriptional activator activity, RNA polymerase II transcription factor binding
          DNA binding
          transcription factor activity, sequence-specific DNA binding
          histone acetyltransferase activity
          protein binding
          chromatin DNA binding
          sequence-specific DNA binding
          protein dimerization activity
          E-box binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Consumer Health Data Privacy Policy Consumer Health Data Privacy Policy
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Notice
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          United States flag icon
          United States

          Your items have has been added!


          Host server : magellan-search-blue-fcf5f9d6d-vrzpg:80/100.66.79.169:80.
          git-commit: 856de8fa7eff2d55603d92afdf035972e45c3e8a
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.51.0-2026.05.21-1.0