Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Molecular Testing
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • How to Order
    • Instrument Support
    • Learning Centers
    • Register for an Account
    • Technical Support Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Promotions
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Promos
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Aspire Member Program
            • Connect: Lab, Data, Apps
            • Custom Products & Projects
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C___8933220_10
          See other SNCA GT Assays ›
          SNP ID:
          rs920624
          Gene
          SNCA SNCA-AS1
          Gene Name
          synuclein alpha
          SNCA antisense RNA 1
          Set Membership:
          -
          Chromosome Location:
          Chr.4: 89827044 - 89827044 on Build GRCh38
          Polymorphism:
          A/T, Transversion substitution
          Context Sequence [VIC/FAM]:

          ACTATAAAACTATAAGTAACACTTA[A/T]AAAATACATATTGTTTGCTTTTGTT

          Assay ID C___8933220_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 163890

          Literature Links:

          SNCA PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          T (0.33)
          (0.67)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          T (0.17)
          (0.83)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          T (0.39)
          (0.61)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          T (0.24)
          (0.76)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          A (0.49)
          (0.51)
          AMR
          T (0.42)
          (0.58)
          SNCA - synuclein alpha
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000345.3 Intron NP_000336.1
          NM_001146054.1 Intron NP_001139526.1
          NM_001146055.1 Intron NP_001139527.1
          NM_007308.2 Intron NP_009292.1
          XM_011532203.1 Intron XP_011530505.1
          XM_011532204.2 Intron XP_011530506.1
          XM_011532205.2 Intron XP_011530507.1
          XM_011532206.1 Intron XP_011530508.1
          XM_011532207.1 Intron XP_011530509.1
          XM_011532208.2 Intron XP_011530510.1
          XM_017008562.1 Intron XP_016864051.1
          XM_017008563.1 Intron XP_016864052.1
          SNCA-AS1 - SNCA antisense RNA 1
          There are no transcripts associated with this gene.

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          membrane trafficking regulatory protein

          Gene Ontology Categories:

          Function(s) Process(es)

          negative regulation of transcription from RNA polymerase II promoter
          microglial cell activation
          positive regulation of receptor recycling
          negative regulation of protein phosphorylation
          positive regulation of neurotransmitter secretion
          fatty acid metabolic process
          neutral lipid metabolic process
          phospholipid metabolic process
          apoptotic process
          activation of cysteine-type endopeptidase activity involved in apoptotic process
          mitochondrial membrane organization
          aging
          adult locomotory behavior
          response to iron(II) ion
          regulation of phospholipase activity
          negative regulation of platelet-derived growth factor receptor signaling pathway
          regulation of glutamate secretion
          regulation of dopamine secretion
          negative regulation of microtubule polymerization
          receptor internalization
          protein destabilization
          response to magnesium ion
          negative regulation of transporter activity
          response to lipopolysaccharide
          negative regulation of monooxygenase activity
          positive regulation of peptidyl-serine phosphorylation
          response to interferon-gamma
          cellular response to oxidative stress
          negative regulation of histone acetylation
          regulation of locomotion
          dopamine biosynthetic process
          response to drug
          mitochondrial ATP synthesis coupled electron transport
          regulation of macrophage activation
          positive regulation of apoptotic process
          negative regulation of apoptotic process
          negative regulation of cysteine-type endopeptidase activity involved in apoptotic process
          extracellular fibril organization
          negative regulation of neuron apoptotic process
          cellular protein metabolic process
          cellular response to fibroblast growth factor stimulus
          positive regulation of endocytosis
          negative regulation of exocytosis
          negative regulation of dopamine metabolic process
          behavioral response to cocaine
          regulation of long-term neuronal synaptic plasticity
          synaptic vesicle endocytosis
          synapse organization
          regulation of acyl-CoA biosynthetic process
          positive regulation of release of sequestered calcium ion into cytosol
          dopamine uptake involved in synaptic transmission
          negative regulation of dopamine uptake involved in synaptic transmission
          negative regulation of serotonin uptake
          negative regulation of norepinephrine uptake
          calcium ion homeostasis
          oxidation-reduction process
          excitatory postsynaptic potential
          long-term synaptic potentiation
          positive regulation of inositol phosphate biosynthetic process
          negative regulation of thrombin receptor signaling pathway
          response to interleukin-1
          cellular response to copper ion
          cellular response to epinephrine stimulus
          positive regulation of protein serine/threonine kinase activity
          negative regulation of neuron death
          negative regulation of mitochondrial electron transport, NADH to ubiquinone
          positive regulation of glutathione peroxidase activity
          positive regulation of hydrogen peroxide catabolic process
          regulation of synaptic vesicle recycling
          regulation of reactive oxygen species biosynthetic process
          negative regulation of chaperone-mediated autophagy
          magnesium ion binding
          fatty acid binding
          copper ion binding
          calcium ion binding
          protein binding
          phospholipid binding
          microtubule binding
          ferrous iron binding
          zinc ion binding
          oxidoreductase activity
          kinesin binding
          protein domain specific binding
          histone binding
          identical protein binding
          alpha-tubulin binding
          cysteine-type endopeptidase inhibitor activity involved in apoptotic process
          phospholipase binding
          transcription regulatory region DNA binding
          dynein binding
          protein N-terminus binding
          tau protein binding
          beta-tubulin binding
          phosphoprotein binding
          phospholipase D inhibitor activity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Consumer Health Data Privacy Policy Consumer Health Data Privacy Policy
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Notice
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          United States flag icon
          United States

          Your items have has been added!


          Host server : magellan-search-blue-64dd947b88-j77tp:80/100.66.75.98:80.
          git-commit: 0f46c0ba67a87c24f5ac662a3edafcaba07cd08c
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.45.0-Offline