Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Molecular Testing
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • How to Order
    • Instrument Support
    • Learning Centers
    • Register for an Account
    • Technical Support Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Promotions
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Promos
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Aspire Member Program
            • Connect: Lab, Data, Apps
            • Custom Products & Projects
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C___9095577_20
          See other ATG16L1 GT Assays ›
          SNP ID:
          rs2241880
          Gene
          ATG16L1 SCARNA5
          Gene Name
          autophagy related 16 like 1
          small Cajal body-specific RNA 5
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.2: 233274722 - 233274722 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          CCCAGTCCCCCAGGACAATGTGGAT[A/G]CTCATCCTGGTTCTGGTAAAGAAGT

          Assay ID C___9095577_20
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 610767 MIM: 615640

          Literature Links:

          ATG16L1 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          C (0.40)
          (0.60)
          Caucasian - Not Available CEPH (CEU)
          T (0.43)
          (0.57)
          EAS
          C (0.32)
          (0.68)
          African American - Not Available YRI (Yoruba)
          C (0.27)
          (0.73)
          SAS
          C (0.50)
          (0.50)
          Chinese - Not Available JPT (Japanese)
          C (0.21)
          (0.79)
          AFR
          C (0.31)
          (0.69)
          Japanese - Not Available CHB (Han Chinese)
          C (0.39)
          (0.61)
          EUR
          T (0.46)
          (0.54)
          AMR
          C (0.32)
          (0.68)
          ATG16L1 - autophagy related 16 like 1
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001190266.1 1143 Missense Mutation ACT,GCT T,A 216 NP_001177195.1
          NM_001190267.1 1143 Missense Mutation ACT,GCT T,A 184 NP_001177196.1
          NM_017974.3 1143 Missense Mutation ACT,GCT T,A 281 NP_060444.3
          NM_030803.6 1143 Missense Mutation ACT,GCT T,A 300 NP_110430.5
          NM_198890.2 1143 Missense Mutation ACT,GCT T,A 137 NP_942593.2
          XM_005246082.2 1143 Missense Mutation ACT,GCT T,A 317 XP_005246139.1
          XM_005246084.2 1143 Missense Mutation ACT,GCT T,A 173 XP_005246141.1
          XM_005246086.2 1143 Missense Mutation ACT,GCT T,A 156 XP_005246143.1
          XM_006712608.2 1143 Missense Mutation ACT,GCT T,A 233 XP_006712671.1
          SCARNA5 - small Cajal body-specific RNA 5
          There are no transcripts associated with this gene.

          Back To Top

          More Information


          Set Membership:

          HapMap

          Gene Ontology Categories:

          Function(s) Process(es)

          autophagosome assembly
          protein transport
          macroautophagy
          negative stranded viral RNA replication
          protein homooligomerization
          protein binding
          ubiquitin-like protein transferase activity
          identical protein binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Consumer Health Data Privacy Policy Consumer Health Data Privacy Policy
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Notice
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          United States flag icon
          United States

          Your items have has been added!


          Host server : magellan-search-blue-fcf5f9d6d-svqt6:80/100.66.77.77:80.
          git-commit: 856de8fa7eff2d55603d92afdf035972e45c3e8a
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.51.0-2026.05.21-1.0