Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Molecular Testing
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • How to Order
    • Instrument Support
    • Learning Centers
    • Register for an Account
    • Technical Support Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Promotions
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Promos
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Aspire Member Program
            • Connect: Lab, Data, Apps
            • Custom Products & Projects
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C____525960_10
          See other ARL5C GT Assays ›
          SNP ID:
          rs529955
          Gene
          ARL5C CACNB1
          Gene Name
          ADP ribosylation factor like GTPase 5C
          calcium voltage-gated channel auxiliary subunit beta 1
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.17: 39175783 - 39175783 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          TGGATGAAGAGGGTGCTGGCTCTAG[A/G]GGAGGGGCCCCGGGGACAAACGGCT

          Assay ID C____525960_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 114207

          Literature Links:

          ARL5C PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          G (0.32)
          (0.68)
          Caucasian - Not Available CEPH (CEU)
          G (0.24)
          (0.76)
          EAS
          G (0.25)
          (0.75)
          African American - Not Available YRI (Yoruba)
          A (0.34)
          (0.66)
          SAS
          G (0.14)
          (0.86)
          Chinese - Not Available JPT (Japanese)
          G (0.16)
          (0.84)
          AFR
          A (0.36)
          (0.64)
          Japanese - Not Available CHB (Han Chinese)
          G (0.28)
          (0.72)
          EUR
          G (0.23)
          (0.77)
          AMR
          G (0.19)
          (0.81)
          ARL5C - ADP ribosylation factor like GTPase 5C
          There are no transcripts associated with this gene.
          CACNB1 - calcium voltage-gated channel auxiliary subunit beta 1
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000723.4 Intron NP_000714.3
          NM_199247.2 Intron NP_954855.1
          NM_199248.2 Intron NP_954856.1
          XM_005257645.2 Intron XP_005257702.1
          XM_005257646.2 Intron XP_005257703.1
          XM_006722072.2 Intron XP_006722135.1
          XM_017025024.1 Intron XP_016880513.1
          XM_017025025.1 Intron XP_016880514.1
          XM_017025026.1 Intron XP_016880515.1
          XM_017025027.1 Intron XP_016880516.1
          XM_017025028.1 Intron XP_016880517.1
          XM_017025029.1 Intron XP_016880518.1
          XM_017025030.1 Intron XP_016880519.1

          Back To Top

          More Information


          Set Membership:

          HapMap

          Panther Classification:

          Molecular Function -

          voltage-gated ion channel

          Gene Ontology Categories:

          Function(s) Process(es)

          transport
          chemical synaptic transmission
          neuromuscular junction development
          cardiac conduction
          calcium ion transmembrane transport
          regulation of voltage-gated calcium channel activity
          voltage-gated calcium channel activity
          high voltage-gated calcium channel activity
          protein kinase binding
          protein domain specific binding
          phosphoprotein binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Consumer Health Data Privacy Policy Consumer Health Data Privacy Policy
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Notice
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          United States flag icon
          United States

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-lnstr:80/100.66.74.145:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline