Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Molecular Testing
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Enterprise Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • How to Order
    • Instrument Support
    • Learning Centers
    • Register for an Account
    • Technical Support Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Promotions
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Promos
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Aspire Member Program
            • Connect: Lab, Data, Apps
            • Custom Products & Projects
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C____996853_20
          See other GATA3 GT Assays ›
          SNP ID:
          rs263425
          Gene
          GATA3 GATA3-AS1
          Gene Name
          GATA binding protein 3
          GATA3 antisense RNA 1
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.10: 8046314 - 8046314 on Build GRCh38
          Polymorphism:
          C/T, Transition substitution
          Context Sequence [VIC/FAM]:

          TGCTTTACATGCCTTTTCTTTCTCT[C/T]GGACACCAACAGGGTGCCTGAGGAA

          Assay ID C____996853_20
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 131320

          Literature Links:

          GATA3 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          T (0.05)
          (0.95)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          T (0.00)
          (1.00)
          African American - Not Available YRI (Yoruba)
          T (0.25)
          (0.75)
          SAS
          T (0.00)
          (1.00)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          T (0.17)
          (0.83)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          T (0.00)
          (1.00)
          AMR
          T (0.02)
          (0.98)
          GATA3 - GATA binding protein 3
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001002295.1 Intron NP_001002295.1
          NM_002051.2 Intron NP_002042.1
          XM_005252442.2 Intron XP_005252499.1
          XM_005252443.4 Intron XP_005252500.1
          GATA3-AS1 - GATA3 antisense RNA 1
          There are no transcripts associated with this gene.

          Back To Top

          More Information


          Set Membership:

          HapMap

          Panther Classification:

          Molecular Function -

          DNA-binding transcription factor

          Gene Ontology Categories:

          Function(s) Process(es)

          negative regulation of transcription from RNA polymerase II promoter
          in utero embryonic development
          cell fate determination
          neuron migration
          type IV hypersensitivity
          kidney development
          mesonephros development
          lens development in camera-type eye
          pro-T cell differentiation
          aortic valve morphogenesis
          cardiac right ventricle morphogenesis
          ventricular septum development
          chromatin remodeling
          transcription from RNA polymerase II promoter
          defense response
          humoral immune response
          signal transduction
          axon guidance
          heart development
          blood coagulation
          negative regulation of cell proliferation
          male gonad development
          response to virus
          anatomical structure morphogenesis
          post-embryonic development
          organ morphogenesis
          positive regulation of signal transduction
          response to gamma radiation
          positive regulation of endothelial cell migration
          regulation of neuron projection development
          phosphatidylinositol 3-kinase signaling
          erythrocyte differentiation
          TOR signaling
          negative regulation of interferon-gamma production
          negative regulation of interleukin-2 production
          positive regulation of interleukin-4 production
          negative regulation of mammary gland epithelial cell proliferation
          embryonic hemopoiesis
          cellular response to interferon-alpha
          ureter maturation
          parathyroid hormone secretion
          regulation of cytokine biosynthetic process
          norepinephrine biosynthetic process
          inner ear morphogenesis
          response to drug
          regulation of CD4-positive, alpha-beta T cell differentiation
          regulation of neuron apoptotic process
          ear development
          response to estrogen
          thymic T cell selection
          T-helper 2 cell differentiation
          innate immune response
          cell fate commitment
          response to ethanol
          positive regulation of T cell differentiation
          negative regulation of fat cell differentiation
          negative regulation of cell cycle
          negative regulation of transcription, DNA-templated
          positive regulation of transcription, DNA-templated
          positive regulation of transcription from RNA polymerase II promoter
          cell maturation
          sympathetic nervous system development
          thymus development
          digestive tract development
          developmental growth
          anatomical structure formation involved in morphogenesis
          negative regulation of inflammatory response
          T cell receptor signaling pathway
          regulation of histone H3-K4 methylation
          positive regulation of protein kinase B signaling
          parathyroid gland development
          pharyngeal system development
          uterus development
          mesenchymal to epithelial transition
          mast cell differentiation
          ureteric bud formation
          regulation of histone H3-K27 methylation
          canonical Wnt signaling pathway involved in metanephric kidney development
          cellular response to interleukin-4
          cellular response to tumor necrosis factor
          positive regulation of histone H3-K14 acetylation
          otic vesicle development
          cellular response to BMP stimulus
          positive regulation of ureteric bud formation
          nephric duct morphogenesis
          nephric duct formation
          regulation of nephron tubule epithelial cell differentiation
          interleukin-4 secretion
          interferon-gamma secretion
          lymphocyte migration
          negative regulation of DNA demethylation
          regulation of establishment of cell polarity
          negative regulation of cell motility
          negative regulation of endothelial cell apoptotic process
          positive regulation of T-helper 2 cell cytokine production
          negative regulation of cell proliferation involved in mesonephros development
          positive regulation of thyroid hormone generation
          positive regulation of histone H3-K9 acetylation
          positive regulation of interleukin-5 secretion
          positive regulation of interleukin-13 secretion
          positive regulation of transcription regulatory region DNA binding
          regulation of cellular response to X-ray
          negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation
          negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation
          transcription regulatory region sequence-specific DNA binding
          RNA polymerase II regulatory region sequence-specific DNA binding
          RNA polymerase II core promoter sequence-specific DNA binding
          core promoter proximal region sequence-specific DNA binding
          core promoter sequence-specific DNA binding
          nucleic acid binding transcription factor activity
          transcriptional activator activity, RNA polymerase II core promoter proximal region sequence-specific binding
          transcriptional repressor activity, RNA polymerase II core promoter proximal region sequence-specific binding
          RNA polymerase II transcription factor binding
          enhancer sequence-specific DNA binding
          transcriptional activator activity, RNA polymerase II transcription regulatory region sequence-specific binding
          DNA binding
          chromatin binding
          transcription factor activity, sequence-specific DNA binding
          transcription coactivator activity
          interleukin-2 receptor binding
          protein binding
          transcription factor binding
          zinc ion binding
          transcription regulatory region DNA binding
          protein dimerization activity
          E-box binding
          HMG box domain binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Consumer Health Data Privacy Policy Consumer Health Data Privacy Policy
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Information Center
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          United States flag icon
          United States

          Your items have has been added!


          Host server : magellan-search-blue-55ff9ddd88-jgzcp:80/100.66.76.55:80.
          git-commit: d366ff9721d93504b2ac26a183b2b3e3d0e7d9ec
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.42.0-2026.01.03-1.0