Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › 478706_mir

          Specificity testing was performed using human anti-targets.

          Assay Name: hsa-miR-133a-5p
          Stem-loop Accession Number: MI0000450
          miRBase Version: v22.1
          Chromosome Location: Chr.18: 21825698 - 21825785 [-] on Build GRCh38
          Mature miRNA Sequence: AGCUGGUAAAAUGGAACCAAAU
          Species: Human, Rat, Alligator mississippiensis, Chrysemys picta, Gadus morhua, Goat, Monodelphis domestica, Ornithorhynchus anatinus, Pig, Pteropus alecto, Python bivittatus, Rhesus monkey, Taeniopygia guttata, Zebrafish
          Product Type: TaqMan™ Advanced miRNA Assay
          Assay ID 478706_mir
          Size S: 250 rxns
          Availability Inventoried
          Catalog # A25576
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details

          Gene Family ID:

          MIPF0000029, mir-133

          Mature miRNA Sequence:

          AGCUGGUAAAAUGGAACCAAAU

          miRBase Details:



          Species miRBase ID miRBase Accession Number
          Human hsa-miR-133a-5p MIMAT0026478
          Rat rno-miR-133a-5p MIMAT0017124
          Alligator mississippiensis ami-miR-133a-5p MIMAT0038146
          Chrysemys picta cpi-miR-133a-5p MIMAT0037750
          Gadus morhua gmo-miR-133a-5p MIMAT0046029
          Goat chi-miR-133a-5p MIMAT0035947
          View More Rows
          Monodelphis domestica mdo-miR-133a-1-5p MIMAT0026665
          Ornithorhynchus anatinus oan-miR-133a-5p MIMAT0006864
          Pig ssc-miR-133a-5p MIMAT0015299
          Pteropus alecto pal-miR-133a-5p MIMAT0039874
          Python bivittatus pbv-miR-133a-5p MIMAT0038935
          Rhesus monkey mml-miR-133c-5p MIMAT0026817
          Taeniopygia guttata tgu-miR-133-5p MIMAT0027005
          Zebrafish dre-miR-133a-5p MIMAT0003404

          Stem-loop Details



          Human

          Stem-loop ID hsa-mir-133a-1
          Stem-loop Accession # MI0000450
          Stem-loop Sequence
          ACAAUGCUUUGCUAGAGCUGGUAAAAUGGAACCAAAUCGCCUCUUCAAUGGAUUUGGUCCCCUUCAACCAGCUGUAGCUAUGCAUUGA
          Chromosome Location Chr. 18 - 21825698 - 21825785 [-] on Build GRCh38
          Mature MicroRNA miRBase Accession #: MIMAT0026478
          miRBase ID: hsa-miR-133a-5p
          Mature miRNA Sequence: AGCUGGUAAAAUGGAACCAAAU
          Chromosome Location: Chr. 18 - 21825698 - 21825785 [-] on Build GRCh38

          Stem-loop ID hsa-mir-133a-2
          Stem-loop Accession # MI0000451
          Stem-loop Sequence
          GGGAGCCAAAUGCUUUGCUAGAGCUGGUAAAAUGGAACCAAAUCGACUGUCCAAUGGAUUUGGUCCCCUUCAACCAGCUGUAGCUGUGCAUUGAUGGCGCCG
          Chromosome Location Chr. 20 - 62564912 - 62565013 [+] on Build GRCh38
          Mature MicroRNA miRBase Accession #: MIMAT0026478
          miRBase ID: hsa-miR-133a-5p
          Mature miRNA Sequence: AGCUGGUAAAAUGGAACCAAAU
          Chromosome Location: Chr. 18 - 21825698 - 21825785 [-] on Build GRCh38

          Rat

          Stem-loop ID rno-mir-133a
          Stem-loop Accession # MI0000906
          Stem-loop Sequence
          CAAUGCUUUGCUAAAGCUGGUAAAAUGGAACCAAAUCGCCUCUUCAAUGGAUUUGGUCCCCUUCAACCAGCUGUAGCUAUGCAUUGA
          Chromosome Location Chr. 18 - 2052478 - 2052564 [-] on Build Rnor_6.0
          Mature MicroRNA miRBase Accession #: MIMAT0017124
          miRBase ID: rno-miR-133a-5p
          Mature miRNA Sequence: AGCUGGUAAAAUGGAACCAAAU
          Chromosome Location: Chr. 18 - 2052478 - 2052564 [-] on Build Rnor_6.0

          Alligator mississippiensis

          Stem-loop ID ami-mir-133a-1
          Stem-loop Accession # MI0029733
          Stem-loop Sequence
          CCAAUGCUUUGCUAAAGCUGGUAAAAUGGAACCAAAUCACCUGUUCAAUGGAUUUGGUCCCCUUCAACCAGCUGUAGCUAUGCAUUGAU
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0038146
          miRBase ID: ami-miR-133a-5p
          Mature miRNA Sequence: AGCUGGUAAAAUGGAACCAAAU
          Chromosome Location: NA

          Stem-loop ID ami-mir-133a-2
          Stem-loop Accession # MI0029734
          Stem-loop Sequence
          CCAAAUGCUUUGCUAAAGCUGGUAAAAUGGAACCAAAUCAACUGUUCAAUGGAUUUGGUCCCCUUCAACCAGCUGUAGCUGUGCAUUGAUCAC
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0038146
          miRBase ID: ami-miR-133a-5p
          Mature miRNA Sequence: AGCUGGUAAAAUGGAACCAAAU
          Chromosome Location: NA

          Chrysemys picta

          Stem-loop ID cpi-mir-133a-1
          Stem-loop Accession # MI0029472
          Stem-loop Sequence
          UCCAAUGCUUUGCUAAAGCUGGUAAAAUGGAACCAAAUCACCUCUUCAAUGGAUUUGGUCCCCUUCAACCAGCUGUAGCUAUGCAUUGAU
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0037750
          miRBase ID: cpi-miR-133a-5p
          Mature miRNA Sequence: AGCUGGUAAAAUGGAACCAAAU
          Chromosome Location: NA

          Stem-loop ID cpi-mir-133a-2
          Stem-loop Accession # MI0029473
          Stem-loop Sequence
          AGGCCAAAUGCUUUGCUAAAGCUGGUAAAAUGGAACCAAAUCAACUGUUCAAUGGAUUUGGUCCCCUUCAACCAGCUGUAGCUGUGCAUUGAUC
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0037750
          miRBase ID: cpi-miR-133a-5p
          Mature miRNA Sequence: AGCUGGUAAAAUGGAACCAAAU
          Chromosome Location: NA

          Gadus morhua

          Stem-loop ID gmo-mir-133a-1
          Stem-loop Accession # MI0037980
          Stem-loop Sequence
          AGCUGGUAAAAUGGAACCAAAUCACCUCUUGAAUGGAUUUGGUCCCCUUCAACCAGCUGU
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0046029
          miRBase ID: gmo-miR-133a-5p
          Mature miRNA Sequence: AGCUGGUAAAAUGGAACCAAAU
          Chromosome Location: NA

          Stem-loop ID gmo-mir-133a-2
          Stem-loop Accession # MI0037981
          Stem-loop Sequence
          AGCUGGUAAAAUGGAACCAAAUCAACUGUUAAAUGGAUUUGGUCCCCUUCAACCAGCUGU
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0046029
          miRBase ID: gmo-miR-133a-5p
          Mature miRNA Sequence: AGCUGGUAAAAUGGAACCAAAU
          Chromosome Location: NA

          Goat

          Stem-loop ID chi-mir-133a
          Stem-loop Accession # MI0030618
          Stem-loop Sequence
          CGGGACCGAAUGCUUUGCUAAAGCUGGUAAAAUGGAACCAAAUCAACUGUUCGAUGGAUUUGGUCCCCUUCAACCAGCUGUAGCUGUGCAUUGAU
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0035947
          miRBase ID: chi-miR-133a-5p
          Mature miRNA Sequence: AGCUGGUAAAAUGGAACCAAAU
          Chromosome Location: NA

          Monodelphis domestica

          Stem-loop ID mdo-mir-133a-1
          Stem-loop Accession # MI0005296
          Stem-loop Sequence
          CAAUGCUUUGCUAAAGCUGGUAAAAUGGAACCAAAUCACCUAUUCAAUGGAUUUGGUCCCCUUCAACCAGCUGUAGCUAUGCAUUGA
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0026665
          miRBase ID: mdo-miR-133a-1-5p
          Mature miRNA Sequence: AGCUGGUAAAAUGGAACCAAAU
          Chromosome Location: NA

          Ornithorhynchus anatinus

          Stem-loop ID oan-mir-133a-1
          Stem-loop Accession # MI0006701
          Stem-loop Sequence
          GGCCUUCGGCAAUGCUUUGCUAAAGCUGGUAAAAUGGAACCAAAUCACCUCUUCAAUGGAUUUGGUCCCCUUCAACCAGCUGUAGCUAUGCAUUGAACACC
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0006864
          miRBase ID: oan-miR-133a-5p
          Mature miRNA Sequence: AGCUGGUAAAAUGGAACCAAAU
          Chromosome Location: NA

          Stem-loop ID oan-mir-133a-2
          Stem-loop Accession # MI0024047
          Stem-loop Sequence
          AGCUGGUAAAAUGGAACCAAAUCAACUGUUCAAUGGAUUUGGUCCCCUUCAACCAGCUGU
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0006864
          miRBase ID: oan-miR-133a-5p
          Mature miRNA Sequence: AGCUGGUAAAAUGGAACCAAAU
          Chromosome Location: NA

          Pig

          Stem-loop ID ssc-mir-133a-1
          Stem-loop Accession # MI0010681
          Stem-loop Sequence
          CGGGACCCAAAUGCUUUGCUAAAGCUGGUAAAAUGGAACCAAAUCAACUGUUGAAUGGAUUUGGUCCCCUUCAACCAGCUGUAGCUGCGCAUUGACAGCGCCG
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0015299
          miRBase ID: ssc-miR-133a-5p
          Mature miRNA Sequence: AGCUGGUAAAAUGGAACCAAAU
          Chromosome Location: NA

          Stem-loop ID ssc-mir-133a-2
          Stem-loop Accession # MI0015909
          Stem-loop Sequence
          UAGAGCUGGUAAAAUGGAACCAAAUCGCCUCUUCAAUGGAUUUGGUCCCCUUCAACCAGCUGUAGCUAUGCAU
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0015299
          miRBase ID: ssc-miR-133a-5p
          Mature miRNA Sequence: AGCUGGUAAAAUGGAACCAAAU
          Chromosome Location: NA

          Pteropus alecto

          Stem-loop ID pal-mir-133a-1
          Stem-loop Accession # MI0032375
          Stem-loop Sequence
          AGCUGGUAAAAUGGAACCAAAUCAACUGUUCGAUGGAUUUGGUCCCCUUCAACCAGCUGU
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0039874
          miRBase ID: pal-miR-133a-5p
          Mature miRNA Sequence: AGCUGGUAAAAUGGAACCAAAU
          Chromosome Location: NA

          Stem-loop ID pal-mir-133a-2
          Stem-loop Accession # MI0032376
          Stem-loop Sequence
          AGCUGGUAAAAUGGAACCAAAUCGCCUCUUCAAUGGAUUUGGUCCCCUUCAACCAGCUGU
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0039874
          miRBase ID: pal-miR-133a-5p
          Mature miRNA Sequence: AGCUGGUAAAAUGGAACCAAAU
          Chromosome Location: NA

          Python bivittatus

          Stem-loop ID pbv-mir-133a-1
          Stem-loop Accession # MI0030228
          Stem-loop Sequence
          AAUGCUUUGCUAAAGCUGGUAAAAUGGAACCAAAUCAACUGUUCAAUGGAUUUGGUCCCCUUCAACCAGCUGUAGCUGUGCAUUG
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0038935
          miRBase ID: pbv-miR-133a-5p
          Mature miRNA Sequence: AGCUGGUAAAAUGGAACCAAAU
          Chromosome Location: NA

          Rhesus monkey

          Stem-loop ID mml-mir-133c
          Stem-loop Accession # MI0007621
          Stem-loop Sequence
          GGGAGCCAAAUGCUUUGCUAGAGCUGGUAAAAUGGAACCAAAUCGACUGUCCAAUGGAUUUGGUCCCCUUCAACCAGCUGUAGCUGUGCAUUGAUGGCGCCG
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0026817
          miRBase ID: mml-miR-133c-5p
          Mature miRNA Sequence: AGCUGGUAAAAUGGAACCAAAU
          Chromosome Location: NA

          Taeniopygia guttata

          Stem-loop ID tgu-mir-133-1
          Stem-loop Accession # MI0013795
          Stem-loop Sequence
          UAAAGCUGGUAAAAUGGAACCAAAUCACCUCUUCAAUGGAUUUGGUCCCCUUCAACCAGCUGUAGCUAUGC
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0027005
          miRBase ID: tgu-miR-133-5p
          Mature miRNA Sequence: AGCUGGUAAAAUGGAACCAAAU
          Chromosome Location: NA

          Stem-loop ID tgu-mir-133-3
          Stem-loop Accession # MI0013797
          Stem-loop Sequence
          UAAAGCUGGUAAAAUGGAACCAAAUCAACUGUUCAAUGGAUUUGGUCCCCUUCAACCAGCUGUAGCUGUGC
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0027005
          miRBase ID: tgu-miR-133-5p
          Mature miRNA Sequence: AGCUGGUAAAAUGGAACCAAAU
          Chromosome Location: NA

          Zebrafish

          Stem-loop ID dre-mir-133a-1
          Stem-loop Accession # MI0001993
          Stem-loop Sequence
          CAUCAAACCACAAUGCUUUGCUAAAGCUGGUAAAAUGGAACCAAAUCACCUCUUCAAUGGAUUUGGUCCCCUUCAACCAGCUGUAGCUAUGCUUUGAUG
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0003404
          miRBase ID: dre-miR-133a-5p
          Mature miRNA Sequence: AGCUGGUAAAAUGGAACCAAAU
          Chromosome Location: NA


          Back To Top

          More Information




          Related Products

          TaqMan™ Pri-miRNA Assay : Hs03303121_pri
          TaqMan™ Pri-miRNA Assay : Hs03303117_pri
          TaqMan™ Pri-miRNA Assay : Rn03465790_pri
          Ambion® Anti-miR™ miRNA Inhibitor : AM11478
          Ambion® Pre-miR™ miRNA Precursor : PM11478
          TaqMan™ MicroRNA Assay : 464986_mat
          mirVana® miRNA inhibitor : MH11478
          mirVana® miRNA mimic : MC11478
          TaqMan™ Advanced miRNA Assay : rno480920_mir


          miRBase Alias:

          Macaca mulatta: mml-miR-133d-5p (v21)

          Back To Top

          Related Products

          • TaqMan® Advanced miRNA cDNA Synthesis Kit
          • TaqMan® Fast Advanced Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          • Social Media
          • Contact Us
          • Report a Site Issue
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Responsibility Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Chile flag icon
          Chile

          Your items have has been added!


          Host server : magellan-search-blue-74d7b4b4d9-p95z8:80/100.66.74.151:80.
          git-commit: 7aafa54bd143a040505a257d2a3ebda4095a617f
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.56.0-Offline