Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Instrument Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • Our Instagram
      Our Instagram
    • Our Facebook
      Our Facebook
    • Blog Behind the Bench
      Blog Behind the Bench
    • Customer Experience Center (CEC)
      Customer Experience Center (CEC)
    • Ecommerce Exclusives
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • New Products
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › 121115_mat
          Assay Name: hsa-miR-103-as
          miRBase Accession Number: MI0007261
          miRBase Version: v22.1
          Chromosome Location: Chr.5: 168560904 - 168560965 [+] on Build GRCh38
          Mature miRNA Sequence: UCAUAGCCCUGUACAAUGCUGCU
          Species: Human, Callithrix jacchus
          Product Type: TaqMan™ MicroRNA Assay
          Assay ID 121115_mat
          Size
          Availability Inventoried
          Catalog # 4427975
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details

          Gene Family ID:

          MIPF0000024, mir-103

          Mature miRNA Sequence:

          UCAUAGCCCUGUACAAUGCUGCU

          Mature miRNA Details:



          Species miRBase ID miRBase Accession Number
          Human hsa-miR-103b MIMAT0007402
          Callithrix jacchus cja-miR-103b MIMAT0039622

          Stem-loop Details



          Human

          Stem-loop ID hsa-mir-103b-1
          Stem-loop Accession # MI0007261
          Stem-loop Sequence
          UCAUAGCCCUGUACAAUGCUGCUUGAUCCAUAUGCAACAAGGCAGCACUGUAAAGAAGCCGA
          Chromosome Location Chr. 5 - 168560904 - 168560965 [+] on Build GRCh38
          Mature MicroRNA miRBase Accession #: MIMAT0007402
          miRBase ID: hsa-miR-103b
          Mature miRNA Sequence: UCAUAGCCCUGUACAAUGCUGCU
          Chromosome Location: Chr. 20 - 3917502 - 3917563 [-] on Build GRCh38

          Stem-loop ID hsa-mir-103b-2
          Stem-loop Accession # MI0007262
          Stem-loop Sequence
          UCAUAGCCCUGUACAAUGCUGCUUGACCUGAAUGCUACAAGGCAGCACUGUAAAGAAGCUGA
          Chromosome Location Chr. 20 - 3917502 - 3917563 [-] on Build GRCh38
          Mature MicroRNA miRBase Accession #: MIMAT0007402
          miRBase ID: hsa-miR-103b
          Mature miRNA Sequence: UCAUAGCCCUGUACAAUGCUGCU
          Chromosome Location: Chr. 20 - 3917502 - 3917563 [-] on Build GRCh38

          Callithrix jacchus

          Stem-loop ID cja-mir-103b-1
          Stem-loop Accession # MI0032158
          Stem-loop Sequence
          GAACAGGUCUCAAUGCCUUCAUAGCCCUGUACAAUGCUGCUUGAUCCAUAUGCAACAAGGCAGCACUGUAAAGAAGCCGAGGGCAGUAAGAAAAUC
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0039622
          miRBase ID: cja-miR-103b
          Mature miRNA Sequence: UCAUAGCCCUGUACAAUGCUGCU
          Chromosome Location: NA

          Stem-loop ID cja-mir-103b-2
          Stem-loop Accession # MI0032157
          Stem-loop Sequence
          AGGGCAGCCCAUUCUUGGUUCUUUCAUAGCCCUGUACAAUGCUGCUUGACCUGAAUGCUACAAGGCAGCACUGUAAAGAAGCUGAAAGCACAAAGACGCAGCUCU
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0039622
          miRBase ID: cja-miR-103b
          Mature miRNA Sequence: UCAUAGCCCUGUACAAUGCUGCU
          Chromosome Location: NA


          Back To Top

          More Information




          Related Products

          TaqMan™ Pri-miRNA Assay : Hs03302758_pri
          TaqMan™ Pri-miRNA Assay : Hs03302763_pri
          Ambion® Anti-miR™ miRNA Inhibitor : AM14174
          Ambion® Pre-miR™ miRNA Precursor : PM14174
          mirVana® miRNA inhibitor : MH14174
          mirVana® miRNA mimic : MC14174
          TaqMan™ Advanced miRNA Assay : 478621_mir


          miRBase Alias:

          Human: hsa-miR-103-as (v16)

          Back To Top

          Related Products

          • TaqMan® Universal Master Mix II, with UNG
          • TaqMan® Universal Master Mix II, no UNG
          • TaqMan® MicroRNA Reverse Transcription Kit
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Find Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Brasil flag icon
          Brasil

          Your items have has been added!


          Host server : magellan-search-green-79565875f6-l699q:80/100.66.79.160:80.
          git-commit: 280dcbe45276d5d6e613c14d399020b8a49b7116
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.57.0-Offline