Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Molecular Testing
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • How to Order
    • Instrument Support
    • Learning Centers
    • Register for an Account
    • Technical Support Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • New Products
  • Promotions
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Promos
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Connect: Lab, Data, Apps
            • Custom Products & Projects
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › Hs03302763_pri
          Assay Name:
          hsa-mir-103a-1
          Stem-loop ID:
          hsa-mir-103a-1 hsa-mir-103b-1
          Mapped to miRBase Version:
          v22.1
          Chromosome Location:
          Chr.5: 168560896 - 168560973 [-] on Build GRCh38
          Stem-loop Location:
          Chr.5: 168560896 - 168560973 [-] on Build GRCh38 Chr.5: 168560904 - 168560965 [+] on Build GRCh38
          Mature miRNA ID:
          hsa-miR-103a-3p hsa-miR-103a-1-5p hsa-miR-103b
          Species:
          Human
          Product Type:
          TaqMan™ Pri-miRNA Assay
          Assay ID Hs03302763_pri
          Size
          Availability Made To Order
          Catalog # 4427012
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details

          Amplicon Length:

          77

          Chromosome Location:

          Chr. 5 - 168560593 - 168560593 [-] on 168560593 Build GRCh38

          Species:

          Human

          miRBase Details:



          Species miRBase ID miRBase Accession Number
          Human hsa-miR-103a-3p MIMAT0000101
          Human hsa-miR-103a-1-5p MIMAT0037306
          Human hsa-miR-103b MIMAT0007402

          Stem-loop Details



          Human

          Stem-loop ID hsa-mir-103a-1
          Stem-loop Accession # MI0000109
          Stem-loop Sequence
          UACUGCCCUCGGCUUCUUUACAGUGCUGCCUUGUUGCAUAUGGAUCAAGCAGCAUUGUACAGGGCUAUGAAGGCAUUG
          Chromosome Location Chr. 5 - 168560896 - 168560973 [-] on Build GRCh38
          Mature MicroRNA miRBase Accession #: MIMAT0000101
          miRBase ID: hsa-miR-103a-3p
          Mature miRNA Sequence: AGCAGCAUUGUACAGGGCUAUGA
          Chromosome Location: Chr. 5 - 168560896 - 168560973 [-] on Build GRCh38

          miRBase Accession #: MIMAT0037306
          miRBase ID: hsa-miR-103a-1-5p
          Mature miRNA Sequence: GGCUUCUUUACAGUGCUGCCUUG
          Chromosome Location: Chr. 5 - 168560896 - 168560973 [-] on Build GRCh38

          Gene Family ID MIPF0000024, mir-103
          Distance to Amplicon 270 bases
          Stem-loop ID hsa-mir-103b-1
          Stem-loop Accession # MI0007261
          Stem-loop Sequence
          UCAUAGCCCUGUACAAUGCUGCUUGAUCCAUAUGCAACAAGGCAGCACUGUAAAGAAGCCGA
          Chromosome Location Chr. 5 - 168560904 - 168560965 [+] on Build GRCh38
          Mature MicroRNA miRBase Accession #: MIMAT0007402
          miRBase ID: hsa-miR-103b
          Mature miRNA Sequence: UCAUAGCCCUGUACAAUGCUGCU
          Chromosome Location: Chr. 5 - 168560904 - 168560965 [+] on Build GRCh38

          Gene Family ID MIPF0000024, mir-103
          Distance to Amplicon 278 bases

          Back To Top

          More Information




          Related Products

          Ambion® Anti-miR™ miRNA Inhibitor : AM10632
          Ambion® Pre-miR™ miRNA Precursor : PM10632
          TaqMan™ MicroRNA Assay : 000439
          mirVana® miRNA inhibitor : MH10632
          mirVana® miRNA mimic : MC10632
          TaqMan™ Advanced miRNA Assay : rno478253_mir
          TaqMan™ Advanced miRNA Assay : mmu478253_mir
          TaqMan™ Advanced miRNA Assay : 478253_mir
          Ambion® Anti-miR™ miRNA Inhibitor : AM14174
          Ambion® Pre-miR™ miRNA Precursor : PM14174
          TaqMan™ MicroRNA Assay : 121115_mat
          mirVana® miRNA inhibitor : MH14174
          mirVana® miRNA mimic : MC14174
          TaqMan™ Advanced miRNA Assay : 478621_mir
          Ambion® Anti-miR™ miRNA Inhibitor : AM19339
          Ambion® Pre-miR™ miRNA Precursor : PM19339
          TaqMan™ MicroRNA Assay : 463628_mat
          mirVana® miRNA inhibitor : MH19339
          mirVana® miRNA mimic : MC19339

          Back To Top

          Related Products

          • High Capacity RNA-to-cDNA Kit
          • SuperScript® IV VILO™ Master Mix
          • TaqMan® Universal PCR Master Mix
          • TaqMan® Fast Advanced Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Notice
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          France flag icon
          France

          Your items have has been added!


          Host server : magellan-search-blue-7fb9f846c9-xq5gc:80/100.66.76.64:80.
          git-commit: 8207b5afa5c305bd40e0a4f0b9b53fd46f2a8829
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.59.1-2026.09.91-1.0