Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture and Transfection
    • Chemicals
    • Chromatography
    • Electron Microscopes
    • Lab Plasticware and Supplies
    • Lab Centrifuges
    • Lab Solutions
    • Mass Spectrometers
    • Next Generation Sequencers
    • See all product categories
  • Applications
    • Brands
    • Industrial and Applied Sciences
    • Food and Beverage
    • Forensics
    • Lab Solutions
    • Life Sciences
    • Pharma and Biopharma
    • Biotechnology
    • Clinical and Diagnostics
    • Digital Solutions
    • See all applications
  • Services
    • Lab Instrument and Equipment Services
    • Custom Services
    • Training Services
    • Financial and Leasing Services
    • Enterprise Level Lab Informatics
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Cell Biology Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • Contact Us
    • Product Documentation
    • Knowledge Base and Product FAQs
    • Learning Centers
    • Supply Center
    • eProcurement Solutions
    • Lab Instrument and Equipment Support
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • New Products
  • Special Offers
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
            • Instrument Management
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › 002497
          Assay Name: mmu-miR-29b*
          miRBase Accession Number: MI0000143
          miRBase Version: v22.1
          Chromosome Location: Chr.6: 31063023 - 31063093 [-] on Build GRCm38
          Mature miRNA Sequence: GCUGGUUUCAUAUGGUGGUUUA
          Species: Mouse
          Product Type: TaqMan™ MicroRNA Assay
          Assay ID 002497
          Size
          Availability Inventoried
          Catalog # 4427975
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details

          Gene Family ID:

          MIPF0000009, mir-29

          Mature miRNA Sequence:

          GCUGGUUUCAUAUGGUGGUUUA

          Mature miRNA Details:



          Species miRBase ID miRBase Accession Number
          Mouse mmu-miR-29b-1-5p MIMAT0004523

          Stem-loop Details



          Mouse

          Stem-loop ID mmu-mir-29b-1
          Stem-loop Accession # MI0000143
          Stem-loop Sequence
          AGGAAGCUGGUUUCAUAUGGUGGUUUAGAUUUAAAUAGUGAUUGUCUAGCACCAUUUGAAAUCAGUGUUCU
          Chromosome Location Chr. 6 - 31063023 - 31063093 [-] on Build GRCm38
          Mature MicroRNA miRBase Accession #: MIMAT0004523
          miRBase ID: mmu-miR-29b-1-5p
          Mature miRNA Sequence: GCUGGUUUCAUAUGGUGGUUUA
          Chromosome Location: Chr. 6 - 31063023 - 31063093 [-] on Build GRCm38


          Back To Top

          More Information


          Associated Megaplex™ RT Primer Pool:

          Megaplex™ RT Primers, Rodent Pool B v3.0


          Associated TaqMan® Array MicroRNA Card:

          TaqMan® Rodent MicroRNA B Cards v3.0


          TaqMan® OpenArray® MicroRNA Panel:

          TaqMan® OpenArray® Rodent MicroRNA Panel




          Related Products

          TaqMan™ Pri-miRNA Assay : Mm03306189_pri
          Ambion® Anti-miR™ miRNA Inhibitor : AM12431
          Ambion® Pre-miR™ miRNA Precursor : PM12431
          mirVana® miRNA inhibitor : MH12431
          mirVana® miRNA mimic : MC12431
          TaqMan™ Advanced miRNA Assay : mmu482721_mir
          MIRNA : TaqMan® Array Rodent MicroRNA A+B Cards Set v3.0
          miRNA Pool : Megaplex™ RT Primers, Rodent Pool B v3.0
          miRNA Card : TaqMan® Rodent MicroRNA B Cards v3.0
          FGMIR : QS TaqMan OpenArray Hu miRNA Plate
          FGMIR : TaqManTM Array Rodent MicroRNA B Card v3
          MIRNA : TaqMan® OpenArray Human MicroRNA Panel
          miRNA Card : TaqMan® Rodent MicroRNA B Cards v2.0
          MIRNA : TaqMan® Array Rodent MicroRNA B Cards v3.0


          miRBase Alias:

          Mouse: mmu-miR-29b-1* (v17)
          Mouse: mmu-miR-29b* (v15)

          Back To Top

          Related Products

          • TaqMan® Universal Master Mix II, with UNG
          • TaqMan® Universal Master Mix II, no UNG
          • TaqMan® MicroRNA Reverse Transcription Kit
          Ordering Plus Icon Minus Icon
          • Quick Order
          • eProcurement
          • Supply Center
          • Order Status
          • Chemicals
          • India Mobile App
          • Government eMarketplace
          Support Plus Icon Minus Icon
          • Order Support
          • Training
          • Contact Us
          • Report a Site Issue
          • Instrument Management
          Resources Plus Icon Minus Icon
          • Product Selection Guides
          • Mobile & Desktop Apps
          • Webinars
          • Blog
          • Social Media
          • New Products
          • Promotions
          • Shared Lists
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Notice
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          India flag icon
          India

          Thermo Fisher Scientific India Pvt Ltd.

          Registered office address:
          402, 403, 404, Delphi 'B' Wing,
          Hiranandani Business Park,
          Powai, Mumbai – 400 076

          Email address: customer.reach@thermofisher.com
          Phone: 1800-2097001
          CIN: U73100MH2000PTC126872

          Invitrogen BioServices (India) Pvt Ltd

          Registered office address:
          First Technology Place, No 3, EPIP,
          Whitefield, Bangalore – 560 079

          Email address: customer.reach@thermofisher.com
          Phone: 1800-2097001
          CIN: U73100KA2004PTC035330

          Your items have has been added!


          Host server : magellan-search-blue-7fb9f846c9-ccbvz:80/100.66.72.150:80.
          git-commit: 8207b5afa5c305bd40e0a4f0b9b53fd46f2a8829
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.59.1-2026.09.91-1.0