PCR Primers

Quicklinks

Related Product Information

Introduction

After cells are isolated from tissue or differentiated from pluripotent precursors, the resulting population needs to be characterized to confirm whether the target population has been obtained. The table below lists PCR primers that can be used in quantitative polymerase chain reactions (qPCR) to measure the expression levels of specific genes for characterizing neural stem cells (NSCs) and their sublineages.

View PCR primers by target

Target Primer         Sequence Tm
(°C)
Amplicon size (bp) Intron size (bp)
Neural stem cells SOX1-F  GCGGAAAGCGTTTTCTTG 53.0 406 No Intron
  SOX1-R  TAATCTGACTTCTCCTCCC 50.2    
  SOX2-F    ATGCACCGCTACGACGTGA 59.3 437  No Intron
  SOX2-R  CTTTTGCACCCCTCCCATTT 56.0    
  NESTIN-F CAGCGTTGGAACAGAGGTTGG 58.6 389 1,142
  NESTIN-R TGGCACAGGTGTCTCAAGGGTAG 60.7    
Oligodendrocytes MAG-F     TCTGGATTATGATTTCAGCC 49.7 366 159
  MAG-R    GCTCTGAGAAGGTGTACTGG 54.7    
  OSP-F  ACTGCTGCTGACTGTTCTTC 55.1 283 5,714
  OSP-R    GTAGAAACGGTTTTCACCAA 50.8    
Astrocytes ALDH1L1-F TCACAGAAGTCTAACCTGCC 55.5 398 21,837
  ALDH1L1-R AGTGACGGGTGATAGATGAT 54.4    
  GFAP-F   GTACCAGGACCTGCTCAAT 55.0 321 2,989
  GFAP-R      CAACTATCCTGCTTCTGCTC 55.3    
Neurons MAP2-F  CCACCTGAGATTAAGGATCA 55.1 482 11,798
  MAP-R  GGCTTACTTTGCTTCTCTGA 55.0    
  ChAT-F ACTGGGTGTCTGAGTACTGG 55.0  451 7,692
  ChAT-R  TTGGAAGCCATTTTGACTAT 54.9    
Endogeneous control ACTB-F  ACCATGGATGATGATATCGC 58.2 281 135
  ACTB-R  TCATTGTAGAAGGTGTGGTG 54.4    
GABAergic/Glutaminergic neurons  GAD1-F GTCGAGGACTCTGGACAGTA  55.3 357 12,277
  GAD1-R GGAAGCAGATCTCTAGCAAA 54.9     
Serotonergic neurons SLC6A4-F GCCTTTTACATTGCTTCCTA 54.8 447 2,251
  SLC6A4-R CCAATTGGGTTTCAAGTAGA 55.2    
Cholinergic neurons ChAT-F  ACTGGGTGTCTGAGTACTGG 55.0 451 7,692
  ChAT-R  TTGGAAGCCATTTTGACTAT 54.9     
Dopaminergic neurons TH-F  TCATCACCTGGTCACCAAGTT 56.0 126 656
    GGTCGCCGTGCCTGTACT 60.0    

 TOP

                  09-May-2012