Invitrogen TrueDesign Genome Editor

Genome editing, simplified

The Invitrogen TrueDesign Genome Editor is a free online tool that enables scientists of all experience levels to easily design, select, and order reagents for accurate and successful gene editing experiments. 

 

Experiment types supported by the TrueDesign Genome Editor

genome editing experiment types with the TrueDesign Genome Editor

Generate a SNP

to introduce a single nucleotide change in your target

 

Achieve highly effective knockout

With insertion of stop codons or targeted indel formation

Delete, insert, or replace up to 30 bases

In any human, mouse, rat, zebrafish, or roundworm gene using CRISPR-Cas9 or TALEN technology

 

Add a GFP or RFP tag

Label a target gene without the need for cloning

We also offer pre-designed synthetic and lentiviral guide RNAs for straightforward knockout of your human or mouse target gene, plus easy online ordering of any custom synthetic sgRNA design.

TrueDesign also enables you to:

  • Order or export designs with one click
    Add all experimental reagents to your cart or download a comprehensive report
  • Verify CRISPR-Cas9 edits
    With custom-designed primers for sequencing or cleavage detection assays

The TrueDesign tool supports five types of edits—gene knockout, fluorescent tagging, insertion, deletion, and SNP replacement—across five species. For each design, it compiles a list of the materials you will need for a successful edit, with the convenience of ordering them from one source and the confidence that they will work together. Our research shows that improved design and delivery of gRNA, Cas9 nuclease, and donor DNA can contribute to enhanced CRISPR/Cas9-mediated genome editing.[1]

[1]  Liang X, Potter J, Kumar S, Ravinder N, Chesnut JD. Enhanced CRISPR/Cas9-mediated precise genome editing by improved design and delivery of gRNA, Cas9 nuclease, and donor DNA. J Biotechnol. 2107; 241: 136-146.   Full text

User guides

The TrueDesign tool follows a simple, three-step workflow: select your gene and transcript, specify your edit, and design your CRISPR and/or TALEN target from our recommendations. At the end, you’ll see a summary where you can review your design and download a list of materials needed or add them to your cart.

 

In this example, we’ll add a GFP tag to the N-terminus of the ACTB gene, which encodes the protein actin.

Select

In the Select step, select the type of edit you want to make and identify the species and gene you want to modify. Then select the transcript from the list generated by the TrueDesign tool. 

The first step in creating your editing design is choosing the experiment type, host genome, and identifying the specific transcript or locus you wish to edit

Edit

In the Edit step, select the region of code if necessary and specify the details of the modification—in this case, adding a GFP tag to the N-terminus of the ACTB gene. We’ll also insert a selection marker to enrich for successfully tagged cells when we later use puromycin to eliminate unedited cells.

On the Edit page, you will find the exact nucleic acid sequence of your gene and make specific design choices that will influence the gRNA and/or donor designs

Design

In the Design step, the tool finds and evaluates CRISPR and TALEN targets to accomplish the edit and recommends the best matches with circled green checkmarks. Select the target(s) you want.

 

TALEN technology is useful when no suitable CRISPR PAM sites are available for your design. It may also be more efficient than CRISPR in editing hard-to-edit genomic regions such as heterochromatin.[2]

On the Design page, you can view the CRISPR or TALEN binding sequences in relation to the edit site, as well as a depiction of the donor or TrueTag primers

Summary

Once your design is complete, a Summary lets you review it and lists all materials that are required or recommended to accomplish your edit. You can select the products you want and add them to your cart, or export them to a spreadsheet with complete details of your design and recommended protocol.

The Summary page provides a chance to review your selections and add products to the cart for a successful genome editing experiment in your lab

 [2] Jain S, Shukla S, Yang C, et al. TALEN outperforms Cas9 in editing heterochromatin target sites. Nat Commun. 2021: 12: 606.  Full text

1. Is your browser supported? Thermo Fisher Cloud includes the latest data security and display features that require the use of one of the following browsers/versions:

            Click on a link above to download and install a compatible browser. Thank you for using Thermo Fisher Cloud.

 

2.  From your supported browser, log in to the Thermo Fisher Cloud using your existing username and password. A verification request email will be sent to the email address on file for your online account. If you don’t immediately receive this verification request, check your spam folder.

Major features in Release 3.0 include the features of prior releases and add the following capabilities:

  1. Select from four additional genomes for a total of five, with support for human (hg38), mouse (mm10), rat (rn6), zebrafish (danRer11), and roundworm (C. elegans, ce11).
  2. Design knockout experiments using either predesigned gRNAs from the TrueGuide library or de novo gRNA and TALEN designs for all species.
  3. Design knockout experiments using a disruptive donor with multiple STOP codons.
  4. Display of an Edit Summary Table during the Edit step.
  5. Improved user interfaces, workflows and visualizations of design choices for multiple edits at a single locus.
  6. Improved CRISPR design algorithm, reducing design time by 56%.
  7. Display of gRNA or TALEN designs in tandem with donor designs.
  8. An improved confirmation primer algorithm to support sequencing analysis using the Applied Biosystems SeqScreener Gene Edit Confirmation App.
  9. Improved usability of the Sequence Editor.
  10. Display transfection protocols in design export files.
  11. Display genome editing illustrations on Summary Page.
  12. Reorganized display of required and recommended reagents on Summary Page.

In Release 2.1, minor bugs and usability issues were resolved to support punchout (B2B) ordering.

Major features in Release 2.0 include the features of Release 1.0 and add the following capabilities:

  1. Add selected oligos, Donor DNA sequences, TrueTag primers, Sequencing/GCD primers, required and recommended products to cart.
  2. Display the progress of CRISPR oligo design in a progress bar percentage.
  3. Display silent mutations on Donor DNA sequences. Silent mutations are introduced into Donor DNA so that they are not disrupted by the Cas9 protein.
  4. Email communication to Services Lab if a user is interested in related TALEN products.

The major features in the initial version include:

  1. Search a gene and list its transcripts, and then view the transcript with nucleic acid and amino acid sequences, exonic and intronic annotations, and translated and untranslated annotations.
  2. Make edits on the transcript sequence and design CRISPR-Cas9 and TALEN sequences for accomplishing that edit.
  3. Choose between TrueTag, Insertion, Deletion, or SNP change edits.
  4. View the CRISPR-Cas9 and TALEN designs, their scores and recommendations made by the app, and select the oligos to view their Donor DNA sequences
  5. Export the CRISPR-Cas9 and TALEN, Donor DNA, and primer sequences along with detailed edit information in an Excel spreadsheet.

Sample data

GFP tagging

This experiment shows the results when the design developed in the extended Workflow example was carried out with U2OS cells, editing the ACTB gene to generate both N- and C-terminal GFP tags for the actin protein. Using the recommended gRNA design GCTATTCTCGCAGCTCACCA (PAM TGG), the forward and reverse primers were used with the TrueTag Donor DNA Kit to amplify a functional donor template. After successful amplification and purification of the donor DNA, it was cotransfected into cells with the gRNA and Cas9 protein.

 

The microscopy images show U2OS cells expressing GFP-tagged ACTB (green), counterstained with Hoechst nuclear dye (blue). The green actin filaments are clearly visible in the edited cells (B) vs negative controls (A). When puromycin selective pressure is applied to these cell pools, the population of cells can be driven to almost 100% as quantified by flow cytometry. A detailed workflow is described in the TrueTag Donor DNA Kit user guide.

Microscopic view of fluorescently labeled cells tagged at the ACTB gene using a TrueTag Donor DNA Kit

ACTB-tagged cells (green), counterstained with Hoechst dye (blue). (A) Negative control and (B) edited cells showing clear actin filament formation with GFP-ACTB fusion proteins. (C) Summary of three experiments where applying puromycin selection can drive these cell populations to >80% GFP-positive cells for the N-terminal constructs and >99% positive cells for the C-terminal constructs. Images were captured on the Invitrogen EVOS FL Color Imaging System.


Get started


TrueTag Donor DNA Kit

The newest addition to our cell engineering portfolio, the Invitrogen TrueTag Donor DNA Kit includes all the necessary reagents to prep your donor DNA. Easy-to-follow protocols help you maximize your editing efficiency.


 

 

TrueTag Donor DNA Kit includes four linear donor templates, Phusion Flash High-Fidelity PCR Master Mix, PCR cleanup columns and buffers and positive control primers to tag human beta-actin (ACTB)

SeqScreener Gene Edit Confirmation tool

The Applied Biosystems SeqScreener Gene Edit Confirmation App, available through Thermo Fisher Connect, can be used to determine the spectrum and frequency of targeted mutations generated in a pool of cells by genome editing tools such as CRISPR. With it you can screen and validate gene editing results obtained using capillary electrophoresis Sanger sequencing technology.

Teal icon of DNA indicating SeqScreener gene editing confirmation software tool

Transfection reagent selection guide

We offer transfection reagents for DNA, siRNA, RNA, and protein delivery, providing a range of options to best suit your transfection experiment. Use our free selection guide to choose between our various cationic-lipid transfection reagents and our electroporation transfection system.



 

Lipofectamine CRISPRMAX Cas9 Transfection Reagent box combined with TrueCut Cas9 protein and TrueGuide guide RNA tubes

Resources and support

TrueDesign Genome Editor application note (PDF)

Access genome editing application resources for more success as you plan and execute your experiments.

Getting started with CRISPR-Cas9? Need proven genome editing protocols? Check out our collection of step-by-step and cell-line specific recommendations.

Find answers to everyday problems with our answers to commonly asked questions.

Master the art of CRISPR editing by tuning into our on-demand three-part webinar series.

Make a free appointment to connect with one of our technical experts to get started or troubleshoot your genome editing project.

Find tips, troubleshooting help, and resources for your genome editing experiments.

Contact our engineering services team for custom engineered cell lines, bulk reagents, and validation and testing services.

Find experts who can help you with the technical aspects of application and product use.

Learn about commercial opportunities.


For Research Use Only. Not for use in diagnostic procedures.